View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9389_high_15 (Length: 225)
Name: NF9389_high_15
Description: NF9389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9389_high_15 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 135 - 225
Target Start/End: Original strand, 47346420 - 47346510
Alignment:
| Q |
135 |
gtctagacaaatctacgagtttatctccaagttttaaaaaacaaatcccataagtaacgtttctcaactcttggtctattattttcctctt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47346420 |
gtctagacaaatctacgagtttatctccaagttttaaaaaacaaatcccataagtaacgtttctcaactcttggtctattattttcctctt |
47346510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 70
Target Start/End: Original strand, 47345678 - 47345733
Alignment:
| Q |
15 |
tatgtaaatagagtgacaaaaattgcatttcaaccttaaaatttgctctcgaaaaa |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47345678 |
tatgtaaatagagtgacaaaaattgcatttcaaccttaaaatttgctctcaaaaaa |
47345733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University