View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9389_low_15 (Length: 377)
Name: NF9389_low_15
Description: NF9389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9389_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 356
Target Start/End: Complemental strand, 34059381 - 34059026
Alignment:
| Q |
1 |
aactcttctctctttcccatacgcgtactgtactctcaccctgcacgtgaatccactttcactgtccggtaccctaaccaaccaaacttgcccttctccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34059381 |
aactcttctctctttcccatacgcgtactgtactctcaccctgcacgtgaatccactttcactgtccggtaccctaaccaaccaaacttgcccttctccc |
34059282 |
T |
 |
| Q |
101 |
accatttccctgtatgcactattcctccacgtcactctcccataaccgtccgatataaatccaggacacgcgtccttctctagtttcactttcctctcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34059281 |
accatttccctgtatgcactattcctccacgtcactctcccataaccgtccgatataaatccaggacacgcgtccttctctagtttcactttcctctcct |
34059182 |
T |
 |
| Q |
201 |
cgtcgtctctactcttcatcaaccactcccacccttcatcaccatgctgccacgtgtcggttacacactcaactgttactactgatcctcctaaccctac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34059181 |
cgtcgtctctactcttcatcaaccactcccacccttcatcaccatgctgccacgtgtcggttacacactcaactgttactactgatcctcctaaccctac |
34059082 |
T |
 |
| Q |
301 |
cgctgtaagatccaccttctccgacgtggtagtgtggccgtgattctcgaagctca |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34059081 |
cgctgtaagatccaccttctccgacgtggtagtgtggccgtgattctcgaagctca |
34059026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 126 - 175
Target Start/End: Complemental strand, 42974394 - 42974345
Alignment:
| Q |
126 |
tccacgtcactctcccataaccgtccgatataaatccaggacacgcgtcc |
175 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| || ||||||| |||| |
|
|
| T |
42974394 |
tccacgtcactctcccgtaaccgtccgatataaaccctggacacgtgtcc |
42974345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University