View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9389_low_30 (Length: 252)
Name: NF9389_low_30
Description: NF9389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9389_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 3921282 - 3921520
Alignment:
| Q |
1 |
agtccagacacaatgttgccatagtggctttcgagggggatgctcagatgacttttcagtttcaacggttgagatggcagccataacagtaagatatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3921282 |
agtccagacacaatgttgccatagtggctttcgagggggatgctcatatgacttttctgtttcaacggttgagatggcagccatagcagtaagatatgga |
3921381 |
T |
 |
| Q |
101 |
ggcgg---------tggcggacaaacccttcagataaaaccttgcatgagacaccgagaaacccgaaccaaagcaggggttgaaagataaatcactcaca |
191 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3921382 |
ggcggtggatgcggtggcggacaaacccttcatataaaaccttgcatgagacaccaagaaatccgaaccaaagcaggggttgaaagataaatcactcaca |
3921481 |
T |
 |
| Q |
192 |
taatcagagcacagtcaaggaaaactcaatcagcggtca |
230 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3921482 |
taatgagagcacagtcaaggaaaactcaatcagcggtca |
3921520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 42523063 - 42522996
Alignment:
| Q |
8 |
acacaatgttgccatagtggctttcgagggggatgctcagatgacttttcagtttcaacggttgagat |
75 |
Q |
| |
|
||||| |||| |||| ||||||||| ||||||| | ||||||||||||| |||||||| ||||||||| |
|
|
| T |
42523063 |
acacagtgttaccatggtggctttcaagggggacgttcagatgactttttagtttcaatggttgagat |
42522996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 194
Target Start/End: Complemental strand, 42522924 - 42522873
Alignment:
| Q |
139 |
gagacaccgagaaacccgaaccaaagcaggggttgaaagataaatcactcacataa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
42522924 |
gagacaccgagaaacccgaaccaaagcag----agaacgataaatcactcacataa |
42522873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University