View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9389_low_43 (Length: 225)

Name: NF9389_low_43
Description: NF9389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9389_low_43
NF9389_low_43
[»] chr3 (2 HSPs)
chr3 (135-225)||(47346420-47346510)
chr3 (15-70)||(47345678-47345733)


Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 135 - 225
Target Start/End: Original strand, 47346420 - 47346510
Alignment:
135 gtctagacaaatctacgagtttatctccaagttttaaaaaacaaatcccataagtaacgtttctcaactcttggtctattattttcctctt 225  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47346420 gtctagacaaatctacgagtttatctccaagttttaaaaaacaaatcccataagtaacgtttctcaactcttggtctattattttcctctt 47346510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 70
Target Start/End: Original strand, 47345678 - 47345733
Alignment:
15 tatgtaaatagagtgacaaaaattgcatttcaaccttaaaatttgctctcgaaaaa 70  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
47345678 tatgtaaatagagtgacaaaaattgcatttcaaccttaaaatttgctctcaaaaaa 47345733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University