View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9390_low_14 (Length: 238)

Name: NF9390_low_14
Description: NF9390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9390_low_14
NF9390_low_14
[»] chr6 (1 HSPs)
chr6 (1-190)||(9065375-9065565)


Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 9065565 - 9065375
Alignment:
1 tcctttattactcaatgattgatgacacgataaattagtgcacagtcctaagacacccc-acatagatgtggtcctcacgatgtttaaacaattgtttta 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
9065565 tcctttattactcaatgattgatgacacgataaattagtgcacagtcctaagacacccccacatagatgtggtcctcacgatgtttaaacaattgtttta 9065466  T
100 aaaatcggatcgaagattgcactagtcaaacttttgaatcatgcgaggttttgtttgttcaatcgattcaatcatagttgaaacatatgac 190  Q
    ||||| |||| |||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
9065465 aaaattggattgaagatcgcactagtcaaacttttgagtcatgcgaggttttgtttgttcaatcgattcaatcatagttgaaacatatgac 9065375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University