View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9390_low_14 (Length: 238)
Name: NF9390_low_14
Description: NF9390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9390_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 9065565 - 9065375
Alignment:
| Q |
1 |
tcctttattactcaatgattgatgacacgataaattagtgcacagtcctaagacacccc-acatagatgtggtcctcacgatgtttaaacaattgtttta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9065565 |
tcctttattactcaatgattgatgacacgataaattagtgcacagtcctaagacacccccacatagatgtggtcctcacgatgtttaaacaattgtttta |
9065466 |
T |
|
| Q |
100 |
aaaatcggatcgaagattgcactagtcaaacttttgaatcatgcgaggttttgtttgttcaatcgattcaatcatagttgaaacatatgac |
190 |
Q |
| |
|
||||| |||| |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9065465 |
aaaattggattgaagatcgcactagtcaaacttttgagtcatgcgaggttttgtttgttcaatcgattcaatcatagttgaaacatatgac |
9065375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University