View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9391_high_15 (Length: 260)

Name: NF9391_high_15
Description: NF9391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9391_high_15
NF9391_high_15
[»] chr5 (1 HSPs)
chr5 (12-244)||(291407-291645)
[»] chr7 (1 HSPs)
chr7 (113-242)||(40260901-40261031)


Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 244
Target Start/End: Original strand, 291407 - 291645
Alignment:
12 gaatttattccactttcaaaactatatcagtgttaaaggggatatataggaaagttggaaagaaccttcaaatcattggtgaacaaaggtttt------t 105  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||      |    
291407 gaatttattccactttcaaaattatatcagtgttaaaggggatatataggaaagttggacagaaccttcaaatcattggtgaacaaaggttttttttttt 291506  T
106 aagaggctgagataaagaattggtttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctg 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
291507 aagaggctgagataaagaattggtttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctg 291606  T
206 caatgtttatgagataattcatggtgtttgggagagaca 244  Q
    |||||||||||||||||||||||||||||||||||||||    
291607 caatgtttatgagataattcatggtgtttgggagagaca 291645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 113 - 242
Target Start/End: Complemental strand, 40261031 - 40260901
Alignment:
113 tgagataaagaattgg-tttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctgcaatgt 211  Q
    ||||||| | |||||| ||||||||||| ||||||||| || | |||||||||| |||||||| |||||||||||||||||| | | |||| || |||||    
40261031 tgagatatataattggctttgattgtgaattctagcaaattcaatggtagttttgggattgaagcggttagtttattgaaactcgttaactatggaatgt 40260932  T
212 ttatgagataattcatggtgtttgggagaga 242  Q
    || ||||| ||||||||||||||||| ||||    
40260931 ttgtgagagaattcatggtgtttgggggaga 40260901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University