View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9391_high_21 (Length: 231)
Name: NF9391_high_21
Description: NF9391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9391_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 213
Target Start/End: Complemental strand, 41980444 - 41980245
Alignment:
| Q |
13 |
attatactgtgaaaaatttgagtagtaatgttttggggattaagcttgttactgtttctggtgctcctttgatttgtggttttgagaattatgcattggt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980444 |
attatactgtgaaaaatttgagtagtaatgttttggggattaagcttgttactgtttctggtgctcctttgatttgtggttttgagaattatgcattggt |
41980345 |
T |
|
| Q |
113 |
gcttaatgaaccttccactcaccctcttcaaggtttttcctcttacaagtattttctttatttctcatattaaaaggtgtgtctggtgtatgacacgttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41980344 |
gcttaatgaaccttccactcaccctcttcaaggtttttcctcttacaagtattttctttatttctcatatt-aaaggtgtgtctggtgtatgacacgttt |
41980246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University