View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9391_low_18 (Length: 327)
Name: NF9391_low_18
Description: NF9391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9391_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 16 - 316
Target Start/End: Complemental strand, 8894108 - 8893808
Alignment:
| Q |
16 |
aaaacctcacatcacagtcacaagtgctgctatctatggcctcaatgcaacttcaccaccagacatgtcaatctcaatgcaattcacaatcttcataagg |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8894108 |
aaaacctcatatcacagtcacaagtgctgcaatctatagcctcaatgctacttcaccgccagacatgtcaatctcaatgcaattcacaatcttcataagg |
8894009 |
T |
 |
| Q |
116 |
aatccaaacaagcgagtatccatttactttgacaggctttccacctttgtgtcatatagaaaccatccgattacacctcatcatatgcttccgtcgcttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8894008 |
aatccaaacaagcgagtatccatttactttgacaggctttccacctttgtgtcatatagaaaccatccgattacacctcatcatatgcttccgtcgcttt |
8893909 |
T |
 |
| Q |
216 |
acttggagaagcatgaaaccgtgtcggtatcaccagttttaggaggcgtgccggttccagtttcggtggatgttttgaatggtttggtgttggatgagaa |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8893908 |
acttggagaagcatgaaaccgtgtcggtatcaccagttttaggaggcgtgccggttccagtttcggtggatgttttgaatggtttggtgttggatgagaa |
8893809 |
T |
 |
| Q |
316 |
t |
316 |
Q |
| |
|
| |
|
|
| T |
8893808 |
t |
8893808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University