View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9391_low_34 (Length: 260)
Name: NF9391_low_34
Description: NF9391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9391_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 244
Target Start/End: Original strand, 291407 - 291645
Alignment:
| Q |
12 |
gaatttattccactttcaaaactatatcagtgttaaaggggatatataggaaagttggaaagaaccttcaaatcattggtgaacaaaggtttt------t |
105 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
291407 |
gaatttattccactttcaaaattatatcagtgttaaaggggatatataggaaagttggacagaaccttcaaatcattggtgaacaaaggttttttttttt |
291506 |
T |
 |
| Q |
106 |
aagaggctgagataaagaattggtttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
291507 |
aagaggctgagataaagaattggtttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctg |
291606 |
T |
 |
| Q |
206 |
caatgtttatgagataattcatggtgtttgggagagaca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
291607 |
caatgtttatgagataattcatggtgtttgggagagaca |
291645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 113 - 242
Target Start/End: Complemental strand, 40261031 - 40260901
Alignment:
| Q |
113 |
tgagataaagaattgg-tttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctgcaatgt |
211 |
Q |
| |
|
||||||| | |||||| ||||||||||| ||||||||| || | |||||||||| |||||||| |||||||||||||||||| | | |||| || ||||| |
|
|
| T |
40261031 |
tgagatatataattggctttgattgtgaattctagcaaattcaatggtagttttgggattgaagcggttagtttattgaaactcgttaactatggaatgt |
40260932 |
T |
 |
| Q |
212 |
ttatgagataattcatggtgtttgggagaga |
242 |
Q |
| |
|
|| ||||| ||||||||||||||||| |||| |
|
|
| T |
40260931 |
ttgtgagagaattcatggtgtttgggggaga |
40260901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University