View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9391_low_42 (Length: 247)
Name: NF9391_low_42
Description: NF9391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9391_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 127 - 229
Target Start/End: Original strand, 11343912 - 11344014
Alignment:
| Q |
127 |
ttcttctctaccgtcaaatcttctctttcatcttccattcttgacccattttccttctctttattgtgatatcccattaaaatcatttttagctgtcatt |
226 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11343912 |
ttcttctctgcagtcaaatcttctctttcatcttccattcttgacccattttccttctctttattgtgatatcccattaaaatcatttttagctgtcatt |
11344011 |
T |
|
| Q |
227 |
gat |
229 |
Q |
| |
|
||| |
|
|
| T |
11344012 |
gat |
11344014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University