View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9391_low_44 (Length: 243)
Name: NF9391_low_44
Description: NF9391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9391_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 42375843 - 42376058
Alignment:
| Q |
17 |
atatctatttacatcaaaaccctaatcacctttgaagcttctgaatgtcatgttttcttcttcttcattttgattttcaggatcatttctgtgatggatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42375843 |
atatctatttacatcaaaaccctaatcacctttgaagcttctgaatgtcatgttttct---tcttcattttgattttcaggatcatttctgtaatggatc |
42375939 |
T |
 |
| Q |
117 |
caactcgaagctgggccgcccgttggttgcgcattggtatgtccattt-tttgttgtaatgcttattataatttgtcttgcccattgccttttagttttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
42375940 |
caactcgaagctgggccgcccgttggttgcgcattggtatgtccatttatctattgtaatgcttattataatatgtcttgcccattgccttttagttctc |
42376039 |
T |
 |
| Q |
216 |
tttccctttacagtattat |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42376040 |
tttccctttacagtattat |
42376058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 42404557 - 42404772
Alignment:
| Q |
17 |
atatctatttacatcaaaaccctaatcacctttgaagcttctgaatgtcatgttttcttcttcttcattttgattttcaggatcatttctgtgatggatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42404557 |
atatctatttacatcaaaaccctaatcacctttgaagcttctgaatgtcatgttttct---tcttcattttgattttcaggatcatttctgtaatggatc |
42404653 |
T |
 |
| Q |
117 |
caactcgaagctgggccgcccgttggttgcgcattggtatgtccattt-tttgttgtaatgcttattataatttgtcttgcccattgccttttagttttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
42404654 |
caactcgaagctgggccgcccgttggttgcgcattggtatgtccatttatctattgtaatgcttattataatatgtcttgcccattgccttttagttctc |
42404753 |
T |
 |
| Q |
216 |
tttccctttacagtattat |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42404754 |
tttccctttacagtattat |
42404772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University