View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9391_low_46 (Length: 243)
Name: NF9391_low_46
Description: NF9391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9391_low_46 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 5 - 243
Target Start/End: Original strand, 36605978 - 36606216
Alignment:
| Q |
5 |
tgagatggacatcagctttggctggctaactttatgaggcctattagttggcaagcttgctggactaacttcacaaacagacttttttccagaaatggaa |
104 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605978 |
tgagatgtacataagctttggctggctaactttatgaggcctattatttggcaagcttactggactaacttcacaaacagacttttttccagaaatggaa |
36606077 |
T |
|
| Q |
105 |
agtgaatgtttgagagaattgatcgaagccatttccttacaaatatcttgaaggtttttgatttcttgtgtgactttggcagacggaacatcaaactcaa |
204 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36606078 |
agtgaatgtttgagagaattgattgaagccatttccttacaaatatcttgaaggtttttgatttcttgtgtgactttggcagacggaacatcacactcaa |
36606177 |
T |
|
| Q |
205 |
cggcatcagatgtagttgtttgatttataagaaaactat |
243 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36606178 |
cgacatcagatgtagttgtttgatttataagaaaactat |
36606216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University