View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9391_low_47 (Length: 241)
Name: NF9391_low_47
Description: NF9391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9391_low_47 |
 |  |
|
| [»] scaffold1099 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 18 - 136
Target Start/End: Complemental strand, 55824919 - 55824801
Alignment:
| Q |
18 |
ctttctgcctttccgttggaagaaaagaagactccttgcactgaaagatcacttattataagcagtaattcttccatacaatttggaaaccatgttaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55824919 |
ctttctgcctttccgttggaagaaaagaagactccttgcactgaaagatcacttattataagcagtaattcttccatacaatttggaaaccatgttaatg |
55824820 |
T |
 |
| Q |
118 |
tttccacctttcttaaatg |
136 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
55824819 |
tttccacctttcttaaatg |
55824801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 18 - 136
Target Start/End: Original strand, 56150062 - 56150180
Alignment:
| Q |
18 |
ctttctgcctttccgttggaagaaaagaagactccttgcactgaaagatcacttattataagcagtaattcttccatacaatttggaaaccatgttaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56150062 |
ctttctgcctttccgttggaagaaaagaagactccttgcactgaaagatcacttattataagcagtaattcttccatacaatttggaaaccatgttaatg |
56150161 |
T |
 |
| Q |
118 |
tttccacctttcttaaatg |
136 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
56150162 |
tttccacctttcttaaatg |
56150180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 162 - 241
Target Start/End: Complemental strand, 55824774 - 55824695
Alignment:
| Q |
162 |
ttgtgcaaatacgatttctcattgttaacatgctggttttctcttctcgatgttcctagaacccttagtagataagtttt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55824774 |
ttgtgcaaatacgatttctcattgttaacatgctggttttctcttctcaatgttcctagaacccttagtagataagtttt |
55824695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 162 - 241
Target Start/End: Original strand, 56150207 - 56150286
Alignment:
| Q |
162 |
ttgtgcaaatacgatttctcattgttaacatgctggttttctcttctcgatgttcctagaacccttagtagataagtttt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
56150207 |
ttgtgcaaatacgatttctcattgttaacatgctggttttctcttctcaatgttcctagaacccttagtagataagtttt |
56150286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1099 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold1099
Description:
Target: scaffold1099; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 197 - 241
Target Start/End: Complemental strand, 2895 - 2851
Alignment:
| Q |
197 |
gttttctcttctcgatgttcctagaacccttagtagataagtttt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2895 |
gttttctcttctcgatgttcctagaacccttagtagataagtttt |
2851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University