View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9391_low_56 (Length: 219)
Name: NF9391_low_56
Description: NF9391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9391_low_56 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0028 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 123031 - 122832
Alignment:
| Q |
1 |
aaagtattccttttacaatgagtcatacatctatgttgcaacaaacatttgtcaacataccaattctaaatatgttactaagacaatcttttaannnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123031 |
aaagtattccttttacaatgagtcatacatctatgttacaacaaacatttgtcaacataccaattctaaatatgttactaagacaatcttttaatttttt |
122932 |
T |
 |
| Q |
101 |
nnagaaggatcaagctctccctattcagaatgttggtacaggcgaggtaaattatatattttgcttttacatcatataaaatgtattcttatgtatttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
122931 |
ttagaaggatcaagctctccctattcagaatgttggtacaggcgaggtaaattatatattttgc-tttacatcatataaaatgtattcttacatatttaa |
122833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University