View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9391_low_58 (Length: 218)
Name: NF9391_low_58
Description: NF9391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9391_low_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 35107402 - 35107254
Alignment:
| Q |
7 |
ttggtggtatggtgtcattggtcatttggaaacatgtcaaggtgatgggaaccattgccaatgtcacgataaaggtaagaatatccactagcatacattt |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35107402 |
ttggtggtatagtgtcattggtcatttggaaacatgtcaaggtgatgggaaccattgccaatgtcacgataaaggtaagaatatccactagcatacattt |
35107303 |
T |
|
| Q |
107 |
taattcttctgcttttccccccttaaactatgttttcactttattgtatct |
157 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
35107302 |
taattcttctgctttt--ccccttaaattatgtttttcctttattgtatct |
35107254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 35107148 - 35107093
Alignment:
| Q |
163 |
aatgttggtgacagatacagtgattttggagtccacacaatacacagctggctcaa |
218 |
Q |
| |
|
||||||| ||||||| ||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
35107148 |
aatgttgctgacagacacagttattttggagttcacacaatacacagctggctcaa |
35107093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University