View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9392_low_37 (Length: 214)
Name: NF9392_low_37
Description: NF9392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9392_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 9 - 130
Target Start/End: Original strand, 45036633 - 45036752
Alignment:
| Q |
9 |
ggtagattattctggacttaagatctatggtgatgttgttgaccatggcatgggttgatactacaatttttctaattnnnnnnnnnnnngatataataat |
108 |
Q |
| |
|
|||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45036633 |
ggtaaattattttggactta-gatctatggtgatgttgttgaccatggcatgggttgatactacaatttttctaatt-aaaaaaaaaaagatataataat |
45036730 |
T |
 |
| Q |
109 |
ttttcttctcaaaactgacttg |
130 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45036731 |
ttttcttctcaaaactgacttg |
45036752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 181
Target Start/End: Original strand, 45036771 - 45036829
Alignment:
| Q |
123 |
ctgacttgggaccttacggtgtgtatctggtttgattcttaaacccaccaattgtttga |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45036771 |
ctgacttgggaccttacggtgtgtatctggtttgattcttaaacccaccaattgtttga |
45036829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University