View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9393_high_2 (Length: 227)
Name: NF9393_high_2
Description: NF9393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9393_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 45524557 - 45524457
Alignment:
| Q |
1 |
ttgcctccagatcatttagataacctgcatttcacttgttcatacatagttaatacaaatttttcataattcatttattaaatcatggctatttatttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45524557 |
ttgcctccagatcatttagataacctgcatttcacttgttcatacatagttaatacaaatttttcataattcatttattaaatcatggctatttatttct |
45524458 |
T |
 |
| Q |
101 |
t |
101 |
Q |
| |
|
| |
|
|
| T |
45524457 |
t |
45524457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 131 - 214
Target Start/End: Complemental strand, 45524407 - 45524324
Alignment:
| Q |
131 |
attggtatatgaaagtggagctgaattgttttgtttggagtcaaagacatcccatgaatgaagagatgacacttcaacctacct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45524407 |
attggtatatgaaagtggagctgaattgttttgtttggagtcaaagacatcccatgaatgaagagatgacacttcaacctacct |
45524324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University