View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9395_low_15 (Length: 372)
Name: NF9395_low_15
Description: NF9395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9395_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 4e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 166 - 285
Target Start/End: Complemental strand, 41714870 - 41714751
Alignment:
| Q |
166 |
catgagcgtagaagtaagtatatatgtttattatagatttaagttattatcacagaattgtttgattacttttatttattgatcgtagacatttaaaaaa |
265 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41714870 |
catgaacgtagaagtaagtatatatgtttattatagatttaagttattatcatagaattgtttgattacttttatttattgatcgtagagatttaaaaaa |
41714771 |
T |
|
| Q |
266 |
gaaatggtataacataccat |
285 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41714770 |
gaaatggtataacataccat |
41714751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University