View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9395_low_20 (Length: 349)
Name: NF9395_low_20
Description: NF9395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9395_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 15 - 326
Target Start/End: Complemental strand, 5800189 - 5799878
Alignment:
| Q |
15 |
gtggtgtatttgatgggcatggaccttttggacatgtggtcgccaagaaagtcagaaattctttccctttaaagctaatggaagaatggaattcgtgtct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5800189 |
gtggtgtatttgatgggcatggaccttttggacatgtggtcgccaagaaagtcagaaattctttccctttaaagctaatggaagaatggaattcgtgtct |
5800090 |
T |
|
| Q |
115 |
tcgtgatgattattnnnnnnnnnnnnnnnnnnnnnnccatttcgagatattgagagaatcatttttgaaagcgtctaagtttatggacaacgaactcaaa |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5800089 |
tcgtgatgattataataataataattataataataaccatttcgagatattgagagaatcatttttgaaagcgtctaagtttatggacaacgaactcaaa |
5799990 |
T |
|
| Q |
215 |
ttgcaatatttcatggaatcttatggcagtgggactaccgctgttaccttgctcaagaaggcatgtacgctatttcatttcttttcatcttatttcgtta |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5799989 |
ttgcaatatttcatggaatcttatggcagtgggactaccgctgttaccttgctcaagaaggcatgtacgctatttcatttcttttcatcttatttcgtta |
5799890 |
T |
|
| Q |
315 |
aaagaatgagag |
326 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5799889 |
aaagaatgagag |
5799878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University