View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9395_low_31 (Length: 257)
Name: NF9395_low_31
Description: NF9395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9395_low_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 27694471 - 27694206
Alignment:
| Q |
1 |
tctaaaaatcttttgtccccaaaccgtgggcccaggcgggtttaaaaggataaaaaatgagtgatgaggcattattgg-------------ttgacttga |
87 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27694471 |
tctaaaaatcttttgtccctaaaccgtgggcccaggcgggtttaaaaggataaaaaatgagtgatgaggcattattgggcggttcatgtggttgacttga |
27694372 |
T |
 |
| Q |
88 |
agtcagcaccaagtgagataattagtccaggtagctagccatgactgactgactgagtcgagcagatcccccaaccaaccccaaaaaatcaaaatggcta |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694371 |
agtcagcaccaagtgagataattagtccaggtagc----catgactgactgactgagtcgagcagatcccccaaccaaccccaaaaaatcaaaatggcta |
27694276 |
T |
 |
| Q |
188 |
tgatgtacggggtactacccattttcgctgccattttaatattgatctctgtgctttccttatatgatac |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
27694275 |
tgatgtacggggtactacccattttcgctgccattttaatattgatctctgtgatttccttctatgatac |
27694206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University