View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9395_low_34 (Length: 250)
Name: NF9395_low_34
Description: NF9395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9395_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 27694870 - 27694633
Alignment:
| Q |
1 |
caccattgtggctgtcttcctatgagtctgaacgggaatcttatgaatggtccatgaataccatcacaacttgattctttgcattggtcatcatgaaaac |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27694870 |
caccattgtggctgtcttcctttgagtctgaacgggaatcttatgaatggtccatgaataccatcacaacttgattctttgcatgggtcatcatgaaaac |
27694771 |
T |
 |
| Q |
101 |
tagtttctgcaattccaactgtaattaaaaagcagaacaagaacacatggatgagaggttttaaccaaatagccatttcgaatgctgatcaatctccatg |
200 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27694770 |
tagtttccgcaatttcaactgtaattaaaaagcagaacaagaacacatggatgagagtttttaaccaaatagccatttcgaatgctgatcaatcaccatg |
27694671 |
T |
 |
| Q |
201 |
tccatctaacaaaccaatatgacttattgaccttgtgc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27694670 |
tccatctaacaaaccaatatgacttattgacctagtgc |
27694633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University