View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9395_low_35 (Length: 244)
Name: NF9395_low_35
Description: NF9395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9395_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 25164626 - 25164848
Alignment:
| Q |
6 |
tagattatacttataccgtgggctgggtcaaaccactgataccagcagccttgacgatcatcattaatttattcaaaactttgaacatatatgttgttta |
105 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25164626 |
tagattctacttataccgtgggctgtgtcaaaccacttataccagcagccttgacgatcatcattaatttattcaaaactttgaacatatatgttgttta |
25164725 |
T |
|
| Q |
106 |
gttagtgtcttcttttaacagaataatcatgcaaacgtttgtttagaatctaattttgcgtacttaattttatgcctaatcaatttttatatactttaat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25164726 |
gttagtgtcttcttttaacagaataatcatgcaaacgtttgtttagaatctaattttgcgtacttaattttttgcctaatcaatttttatatactttaat |
25164825 |
T |
|
| Q |
206 |
cattacaatcaacttaagtatct |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25164826 |
cattacaatcaacttaagtatct |
25164848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University