View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9395_low_37 (Length: 242)

Name: NF9395_low_37
Description: NF9395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9395_low_37
NF9395_low_37
[»] chr3 (1 HSPs)
chr3 (9-242)||(24885045-24885278)


Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 9 - 242
Target Start/End: Complemental strand, 24885278 - 24885045
Alignment:
9 ggacatcatttcccgattcaaggagaggaggcaaggaccttggaactggtccgagttcccgacaaaggttgccgtacaattgaatgatacccacccaacc 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||    
24885278 ggacatcatttcccgattcaaggagaggaggcaaggaccttggaactggtccgagttcccgacaaaggttgctatacaattgaatgatacccacccaacc 24885179  T
109 ctttcaatacctgagttgatgcgtttacttatggacgaagaagggcttggatgggatgaagcatgggaggttacatcaaagtcagtaaattgcagaactt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24885178 ctttcaatacctgagttgatgcgtttacttatggacgaagaagggcttggatgggatgaagcatgggaggttacatcaaagtcagtaaattgcagaactt 24885079  T
209 attgcgttgtgtggaaaagttgttttccatattc 242  Q
    ||||||||||||||||||||||||||||||||||    
24885078 attgcgttgtgtggaaaagttgttttccatattc 24885045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University