View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9395_low_41 (Length: 235)
Name: NF9395_low_41
Description: NF9395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9395_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 21120867 - 21120665
Alignment:
| Q |
17 |
tactttccaatgccaatttgagtttgctaatttagcttaaaataaaataaaaattaactgtcttaactagtttatggacaatttcaattgttgtctttgc |
116 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21120867 |
tactttccaatgccaatttgggttggctaatttagcttaaaataaaataaaaattaactgtcttaactagtttatggacaatttcaattgttgtctttgc |
21120768 |
T |
|
| Q |
117 |
agaaactcaacactataatttgtataaaattgtttaaacaaccttagctaatttatggataatttcatttgtttcgtctttgcataaactcaacactata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21120767 |
agaaactcaacactataatttgtataaaattgtttaaacaaccttagctaatttatggataatttcatttgtttcgtctttgcataaactcaacactata |
21120668 |
T |
|
| Q |
217 |
acc |
219 |
Q |
| |
|
||| |
|
|
| T |
21120667 |
acc |
21120665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University