View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9396_high_7 (Length: 208)
Name: NF9396_high_7
Description: NF9396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9396_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 83 - 189
Target Start/End: Complemental strand, 32482755 - 32482649
Alignment:
| Q |
83 |
ccataattctaaattacctctgtaagatgaaacatcatcgtttttgttgtaccaaaatagtgtctcttgtggtggaatatgaccttgttgttgtgattct |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482755 |
ccataattctaaattacctctgtaagatgaaacatcatcgtttttgttgtaccaaaatagtgtctcttgtggtggaatatgaccttgttgttgtgattct |
32482656 |
T |
|
| Q |
183 |
tctcctt |
189 |
Q |
| |
|
||||||| |
|
|
| T |
32482655 |
tctcctt |
32482649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 46
Target Start/End: Complemental strand, 32482822 - 32482792
Alignment:
| Q |
16 |
ggaagaacggccgtgcagcatgcatatcatc |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32482822 |
ggaagaacggccgtgcagcatgcatatcatc |
32482792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University