View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9396_low_12 (Length: 347)
Name: NF9396_low_12
Description: NF9396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9396_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 158 - 335
Target Start/End: Original strand, 28031341 - 28031518
Alignment:
| Q |
158 |
aataaacatagtagaagtttcaattttgtaacatttattatgtggtctcgaattacaacgattgttgtaacttaacttggcattttatcgttctcataaa |
257 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28031341 |
aataaacataatagaagtttcaattttgtaacatttattatgtggtctcgaattacaacgattgttgtaacttaacttggcattttatcgttctcataaa |
28031440 |
T |
|
| Q |
258 |
tatatctttgttttcatatttgtaattttattaaacttgatagttttagtaaatattacttggaattttattaagtat |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28031441 |
tatatctttgttttcatatttgtaattttattaaacttgatagttttagtaaatattacttggaattttattaagtat |
28031518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 19 - 120
Target Start/End: Original strand, 28031033 - 28031134
Alignment:
| Q |
19 |
tgtgccactagtagatcaagagtggctggatcgcttatgattcattacctgccaaagtgattcttgcaccattttgaatatgtgaagactatcctattct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28031033 |
tgtgccactagtagatcaagagtggctggatcacttatgattcattacctgccaaagtgattcttgcaccattttgaatatgggaagactatcctattct |
28031132 |
T |
|
| Q |
119 |
tt |
120 |
Q |
| |
|
|| |
|
|
| T |
28031133 |
tt |
28031134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 175
Target Start/End: Original strand, 28031210 - 28031261
Alignment:
| Q |
124 |
taccaaaagcataagagaaggggaacgggtgcacaataaacatagtagaagt |
175 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28031210 |
taccaaaagcataagagaacgggaacgggtgcacaataaacatagtagaagt |
28031261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University