View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9396_low_18 (Length: 208)

Name: NF9396_low_18
Description: NF9396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9396_low_18
NF9396_low_18
[»] chr8 (2 HSPs)
chr8 (83-189)||(32482649-32482755)
chr8 (16-46)||(32482792-32482822)


Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 83 - 189
Target Start/End: Complemental strand, 32482755 - 32482649
Alignment:
83 ccataattctaaattacctctgtaagatgaaacatcatcgtttttgttgtaccaaaatagtgtctcttgtggtggaatatgaccttgttgttgtgattct 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32482755 ccataattctaaattacctctgtaagatgaaacatcatcgtttttgttgtaccaaaatagtgtctcttgtggtggaatatgaccttgttgttgtgattct 32482656  T
183 tctcctt 189  Q
    |||||||    
32482655 tctcctt 32482649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 46
Target Start/End: Complemental strand, 32482822 - 32482792
Alignment:
16 ggaagaacggccgtgcagcatgcatatcatc 46  Q
    |||||||||||||||||||||||||||||||    
32482822 ggaagaacggccgtgcagcatgcatatcatc 32482792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University