View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9399_low_31 (Length: 238)
Name: NF9399_low_31
Description: NF9399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9399_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 22 - 215
Target Start/End: Complemental strand, 41936120 - 41935927
Alignment:
| Q |
22 |
cgtagtataattgtgtgaatgcatgagtcttttactatttcataactagaagtataagcgagttgagacaaataataagggtccatctttagatcctttt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41936120 |
cgtagtataattgtgtgaatgcatgagtcttttactatttcataactagaagtttaagcaagttgagacaaatagtaagggtccatctttagatcctttt |
41936021 |
T |
 |
| Q |
122 |
ttactgtccatgttagacaaatcttatatgcaatatgaagtacatactttatgttttaatgcactagtataaaagtaattgaaaagtagaatta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41936020 |
ttactgtccatgttagacaaatcttatatgcgatatgaagtgcataccttatgttttaatgcactagtatataagtaattgaaaagtagaatta |
41935927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University