View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9400_low_8 (Length: 288)
Name: NF9400_low_8
Description: NF9400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9400_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 32803975 - 32803712
Alignment:
| Q |
1 |
attacttcattattataacatctttgtctcactgtctatgttctaaatttttatttcttaattctctctctttttacttgagttgagtctctgaaaggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32803975 |
attacttcattattataacatctttgtctcactgtctatgttctaaatttttatttcttaattctctctctttttacttgagttgagtctctgaaaggtt |
32803876 |
T |
|
| Q |
101 |
tggtatctcttctatcttgtaaccaatagaataaacaaaacaaataaatgaaagaaagnnnnnnnnnttagacagtg---nnnnnnnnaatcaaacccct |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
32803875 |
tggtatctcttctatcttgtaaccaatagaataaacaaaacaaataaatgaaagaaa-----aaaaattagacagtgtttttttttttaatcaaacccct |
32803781 |
T |
|
| Q |
198 |
tacttgattctcatccaataattgcatctaattctctcttctaagcacctcatcactttcctttaccctatc |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32803780 |
tacttgattctcatccaataattgcatctaattctctcttctaagca---catcactttcctttaccctatc |
32803712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University