View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9400_low_9 (Length: 288)

Name: NF9400_low_9
Description: NF9400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9400_low_9
NF9400_low_9
[»] chr3 (2 HSPs)
chr3 (15-288)||(49392098-49392371)
chr3 (180-288)||(51312066-51312174)
[»] chr5 (1 HSPs)
chr5 (23-285)||(31726345-31726607)
[»] chr4 (3 HSPs)
chr4 (23-100)||(22278805-22278882)
chr4 (220-288)||(22278647-22278715)
chr4 (136-183)||(22278748-22278793)
[»] chr7 (1 HSPs)
chr7 (207-285)||(47531754-47531832)


Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 15 - 288
Target Start/End: Complemental strand, 49392371 - 49392098
Alignment:
15 gacatcatacgagactgagatacgacgagggagaaacagacacaagagttgatggtggtgacgggaagagtgtaacgatgacgaagaggaagggtagaag 114  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
49392371 gacatcatacgagactgagatacgatgagggagaaacagacacaagagtttatggtggtgacgggaagagtgtaacgatgacgaagaggaagggtagaag 49392272  T
115 agaacgagtgtccattgaaagggtggtggtcgctgttgcgatggcggttgtaacgaggatggtgggggaaagaaaatacacgcagtaaagaaaggaggaa 214  Q
    ||||||||||| | |||| ||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||    
49392271 agaacgagtgttcgttgagagggtggtggtcgttgttgcgatggcggttgtaacgaggacggtgggggaaagaaaacacacgcagtaaagaaaggaggaa 49392172  T
215 gagacaggaagaagaggattgtcgtgcatttacaaaactacccccgctttaagggtgaaatatccaaattaccc 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49392171 gagacaggaagaagaggattgtcgtgcatttacaaaactacccccgctttaagggtgaaatatccaaattaccc 49392098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 288
Target Start/End: Complemental strand, 51312174 - 51312066
Alignment:
180 gggaaagaaaatacacgcagtaaagaaaggaggaagagacaggaagaagaggattgtcgtgcatttacaaaactacccccgctttaagggtgaaatatcc 279  Q
    ||||||||||| ||||  || | ||| |||| ||||||| | ||| |||| | |||| ||| |||||||||| | |||| | || |||||||||||||||    
51312174 gggaaagaaaacacacagagaagagagaggaagaagagagaagaaaaagatggttgtggtgtatttacaaaattgcccctgtttaaagggtgaaatatcc 51312075  T
280 aaattaccc 288  Q
    |||||||||    
51312074 aaattaccc 51312066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 23 - 285
Target Start/End: Complemental strand, 31726607 - 31726345
Alignment:
23 acgagactgagatacgacgagggagaaacagacacaagagttgatggtggtgacgggaagagtgtaacgatgacgaagaggaagggtagaagagaacgag 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| | | ||||||||||||||  | |||||||| |||||||||    
31726607 acgagactgagatacgacgagggagaaacagacacaagagttgatggtggcgacgagaacaatttaacgatgacgaagtcggagggtagaggagaacgag 31726508  T
123 tgtccattgaaagggtggtggtcgctgttgcgatggcggttgtaacgaggatggtgggggaaagaaaatacacgcagtaaagaaaggaggaagagacagg 222  Q
     ||||   || |||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||| | || ||| ||||||||||||||||||||||    
31726507 cgtccgccgagagggtggtggtcgctgttgcgatggcggttataacgaggacggtgagggaaagaaaacaaacacagaaaagaaaggaggaagagacagg 31726408  T
223 aagaagaggattgtcgtgcatttacaaaactacccccgctttaagggtgaaatatccaaatta 285  Q
    |||||||||||||| |||||||||||| ||| |||| ||||||||||||||||||||||||||    
31726407 aagaagaggattgtggtgcatttacaacactgcccctgctttaagggtgaaatatccaaatta 31726345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 23 - 100
Target Start/End: Complemental strand, 22278882 - 22278805
Alignment:
23 acgagactgagatacgacgagggagaaacagacacaagagttgatggtggtgacgggaagagtgtaacgatgacgaag 100  Q
    |||||||||||||||||| | | ||||||||||||||||||||||||||| |||||||||||| |  |||||||||||    
22278882 acgagactgagatacgacaacgaagaaacagacacaagagttgatggtggcgacgggaagagtttggcgatgacgaag 22278805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 220 - 288
Target Start/End: Complemental strand, 22278715 - 22278647
Alignment:
220 aggaagaagaggattgtcgtgcatttacaaaactacccccgctttaagggtgaaatatccaaattaccc 288  Q
    |||||||||||| |||| ||| ||||||||||||  ||  |||||||| ||||||||||||||||||||    
22278715 aggaagaagagggttgtggtgtatttacaaaactgtccatgctttaagagtgaaatatccaaattaccc 22278647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 136 - 183
Target Start/End: Complemental strand, 22278793 - 22278748
Alignment:
136 ggtggtggtcgctgttgcgatggcggttgtaacgaggatggtggggga 183  Q
    |||||||||||||||||  || |||||||||||||||| |||||||||    
22278793 ggtggtggtcgctgttg--atagcggttgtaacgaggacggtggggga 22278748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 207 - 285
Target Start/End: Complemental strand, 47531832 - 47531754
Alignment:
207 aggaggaagagacaggaagaagaggattgtcgtgcatttacaaaactacccccgctttaagggtgaaatatccaaatta 285  Q
    |||| ||||||| | ||||||||||||||| ||| |||||||||| | |||| | || |||||||||||||||||||||    
47531832 aggaagaagagagaagaagaagaggattgtggtgtatttacaaaattgcccctgtttaaagggtgaaatatccaaatta 47531754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University