View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9401_high_23 (Length: 374)
Name: NF9401_high_23
Description: NF9401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9401_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 18 - 364
Target Start/End: Complemental strand, 27111920 - 27111574
Alignment:
| Q |
18 |
ctttgagaaggtgtagttggtttaagatcttcatttgtgagtgatggatcaagttcaaattcatggtttttgaatggttgcatgtggatagaatttgaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27111920 |
ctttgagaaggtgtagttggtttaagatcttcatttgtgagtgatggatcaggttcaaattcatggtttttgaatggttgcatgtggatagaatttgaag |
27111821 |
T |
 |
| Q |
118 |
aagagtttgaacatttcattgaagagtgttttgaattaccatgcattgggtttgttggttttgatggaatgggaagatgagtggaagggtaaaagggtct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27111820 |
aagagtttgaacatttcattgaagagtgttttgaattaccatgcattgggtttgttggttttgatggaatgggaagatgagtggaagggtaaaagggtct |
27111721 |
T |
 |
| Q |
218 |
tagaaaaggagtggtggagtgatgatggagggttagagttaaggatttgagtagcatgttgttcattgtagattgtaaagtttcaggtggttgtagaatg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27111720 |
tagaaaaggagtggtggagtgatgatggagggttagagttaaggatttgagtagcatgttgttcattgtagattgtaaagtttcaggtggttgtagaatg |
27111621 |
T |
 |
| Q |
318 |
tagagatagataaatgagtgatctctattgtacaacgtcattctctg |
364 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27111620 |
taaagatagataaatgagtgatctctattgtacaacgtcattctctg |
27111574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University