View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9401_high_46 (Length: 243)
Name: NF9401_high_46
Description: NF9401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9401_high_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 227
Target Start/End: Original strand, 13867696 - 13867908
Alignment:
| Q |
14 |
aacctgtggggcaccaatatcatcgtcacagttacttccgttgcctccgtcgtccaaacctggatcgaaaaggcgctccaactccgtagcgatgtctatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13867696 |
aacctgtggggcaccaatatcatcgtcacagttacttccgttgcctcc-tcgtccaaacctggatcgaaaaggcgctccaactccgtagcgatgtctatc |
13867794 |
T |
 |
| Q |
114 |
ccaagtttaccttcatcataggcttcaccattgatccggacataaacacattgcagttctgtgttggtcatcgctgcctcattttccagctcgctcatgc |
213 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13867795 |
ccaagtttaccttcatcttaggcttcgccattgatccggacataaacacgttgcagttctgtgttggtcatcgctgcctcagtttccagctcgctcatgc |
13867894 |
T |
 |
| Q |
214 |
agctaccataccgg |
227 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
13867895 |
agctaccacaccgg |
13867908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 95 - 225
Target Start/End: Complemental strand, 11876512 - 11876382
Alignment:
| Q |
95 |
ctccgtagcgatgtctatcccaagtttaccttcatcataggcttcaccattgatccggacataaacacattgcagttctgtgttggtcatcgctgcctca |
194 |
Q |
| |
|
||||||| |||||||| | ||||| ||| |||||||| ||||| |||| ||||| | |||||||||||||||||| ||| | | |||||||||| |
|
|
| T |
11876512 |
ctccgtaatgatgtctaccgcaagtctacattcatcatcggctttgccatcgatccttaggtaaacacattgcagttctcccttgctgaccgctgcctca |
11876413 |
T |
 |
| Q |
195 |
ttttccagctcgctcatgcagctaccatacc |
225 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |
|
|
| T |
11876412 |
ttttccagctcgctcgcgcagataccatacc |
11876382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University