View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9401_low_111 (Length: 241)
Name: NF9401_low_111
Description: NF9401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9401_low_111 |
 |  |
|
| [»] scaffold0314 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0314 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: scaffold0314
Description:
Target: scaffold0314; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 17557 - 17764
Alignment:
| Q |
14 |
cacagaccaaacatacaccaaaaatcaattttagaatcaaaatcttcaaatttgtttcaagtcaaaacaaaacnnnnnnnnnnnnnnnngttacttggag |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17557 |
cacaaaccaaacatacaccaaaaatcaattttagaatcaaaatcttcaaatttgtttcaagtcaaaacaaaacagagagagagagag--gttacttggag |
17654 |
T |
 |
| Q |
114 |
gtgagagaagggaattgaaacggtggagtaagaagacatagtatggcggggaacgactgcgttttgaggaacaaggggcgggaatggagacgagttccac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17655 |
gtgagagaagggaattgaaacggtggagtaagaagacatagtatggcggggaacgactgcgttttgaggaacaaggggcgggaatggagacgagttcaac |
17754 |
T |
 |
| Q |
214 |
atgcgaatgg |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
17755 |
atgcgaatgg |
17764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University