View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9401_low_126 (Length: 228)
Name: NF9401_low_126
Description: NF9401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9401_low_126 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 132673 - 132456
Alignment:
| Q |
1 |
cctcattgaaggccttcgtgagatcaatgtcgctgtttggaactacaattctgtcacctctgatgactttatcggcaccggaaaggttcaattgcacaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
132673 |
cctcattgaaggccttcgtgagatcaatgtcgctgtttggaactacaatactgtcacctctgatgactttatcggcaccggaaaggttcaattgcacaag |
132574 |
T |
 |
| Q |
101 |
gttctctctcaaggttttgatgactctgcatggccacttcaaactaaaaatggcaggtatatatgttatgcctctttctgttgctattgctattgtacct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
132573 |
gttctctctcaaggttttgatgactctgcatggccacttcaaactaaaaatggcaggtatatatgttatgcctatttctgttgctattgc-----tacct |
132479 |
T |
 |
| Q |
201 |
tcgtttaatttacccattcattt |
223 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
132478 |
tcatttaatttacccattcattt |
132456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 85 - 192
Target Start/End: Original strand, 160963 - 161070
Alignment:
| Q |
85 |
ggttcaattgcacaaggttctctctcaaggttttgatgactctgcatggccacttcaaactaaaaatggcaggtatatatgttatgcctctttctgttgc |
184 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||||| | |||||||||| |
|
|
| T |
160963 |
ggttcaattacacaaagttctctctcaaggttttgatgactcttcctggccacttcaaactaaaactggcaggtatatatgttatgcttatttctgttgc |
161062 |
T |
 |
| Q |
185 |
tattgcta |
192 |
Q |
| |
|
|||||||| |
|
|
| T |
161063 |
tattgcta |
161070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 85
Target Start/End: Original strand, 160798 - 160878
Alignment:
| Q |
5 |
attgaaggccttcgtgagatcaatgtcgctgtttggaactacaattctgtcacctctgatgactttatcggcaccggaaag |
85 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||| |||| | ||| ||| ||||| |||||||||||||||||| |
|
|
| T |
160798 |
attgaaggccttcgtgagatcaatgttgtcgtttggaacagcaataccgtctccttcgatgattttatcggcaccggaaag |
160878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University