View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9401_low_71 (Length: 334)
Name: NF9401_low_71
Description: NF9401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9401_low_71 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 12 - 334
Target Start/End: Original strand, 54474930 - 54475244
Alignment:
| Q |
12 |
agcaaagggagcagtgagtacggtgcaactagtgagtatggactcaacctttctgcctcgagcagtgatcaatcttctgttgattatactaggaggacgg |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54474930 |
agcacagggagcagtgagtacggtgcaactagtgagtatggactcaacctttccgcctcgagcagtgatcaatcttctgttgattatactaggaggacgg |
54475029 |
T |
 |
| Q |
112 |
taactggaaccggaggcggatcaaaattccatgaaaaataaagcctgatatgatcctattttatttgttaactagctagatagctagcaaaagtaacagc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54475030 |
taactggaaccggaggcggatcaaaattccatgaaaaataaagcctgatatgatcctattttatttgttaactagctagatagctagcaaaagtaacagc |
54475129 |
T |
 |
| Q |
212 |
tgattatctagcgatatgattttaattcaggccatggcataaaattataaaattagtgccacagggaaagaaatacatgacagagttatattcttttgtg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54475130 |
tgattatctagcgatatgattttaattcaggccatggc--------ataaaattagtgccacagggaaagaaatacatgacagagttatattcttttgtg |
54475221 |
T |
 |
| Q |
312 |
actttttgtatgattcattgata |
334 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
54475222 |
actttttgtatgattcattgata |
54475244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University