View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9401_low_84 (Length: 287)
Name: NF9401_low_84
Description: NF9401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9401_low_84 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 8 - 275
Target Start/End: Original strand, 3345584 - 3345853
Alignment:
| Q |
8 |
atggtgtttcgaagtttttgttggtggtgttgnnnnnnnnattcttgtaggttggttacattgcattgactattttattctattctttgaacaccttatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3345584 |
atggtgtttcgaagtttttgttggtggtattgttttttctattcttgtaggttggttacgttgcattgactattttattctattctttaaacaccttatg |
3345683 |
T |
|
| Q |
108 |
ctagaataatttgtaatacataatttttgtttggcttttnnnnnnn--tcataagatatcccctataaacttaaatcaattttgactacttgcatcatct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
3345684 |
ctagaataatttgtaatacataatttttgtttggcttttaaaaaataatcataagatatcccctataaacttaaatcaattttgactacttacatcattt |
3345783 |
T |
|
| Q |
206 |
tcgtttagacatatagtatcaatttttagtcatgtcaagaggagcaacttgcaaaacacaagttgagatt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3345784 |
tcgtttagacatatagtatcaatttttagtcatgtcaagaggagcaacttgcaaaacacaagttgagatt |
3345853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University