View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9401_low_86 (Length: 282)
Name: NF9401_low_86
Description: NF9401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9401_low_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 32 - 193
Target Start/End: Original strand, 34453208 - 34453369
Alignment:
| Q |
32 |
aaaaaagatacagagttatcaatcacaaaaatcgaccaaaatattggtgtctccaaactaagaaaaaattggttgatcaaattaaagataaagtcattcc |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34453208 |
aaaaaagatacagagttatcaatcacaaaaatcgaccaaaatattggtgtctccaaactaagaaaaaattggttgatcaaattaaagataaagtcattcc |
34453307 |
T |
 |
| Q |
132 |
taaatatatgagagatcgagtacaccattaatagaaaccaaatgaaatactttggttttgga |
193 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34453308 |
taaatatatgagagatcgaatacaccattaatagaaaccaaatgaaatactttggttttgga |
34453369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University