View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9401_low_93 (Length: 263)
Name: NF9401_low_93
Description: NF9401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9401_low_93 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 13120349 - 13120580
Alignment:
| Q |
13 |
atgtggatagaaaagaacttggcgtgagatgcacacttgataattagggatatattctcctaaacttttacccatcaaaacgaatcaaacttgtaagtta |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13120349 |
atgtggat-gaaaagaacttggcgtgagatgcacacttgataattagggatatattctcctaaacttttacccatcaaaacgaatcaaacttgtaagtta |
13120447 |
T |
|
| Q |
113 |
attaaattaaattatcaaatcatatatccttaattgaacaagtagcaatagattccatccgttgcatgcatatttataatgttggcttagttggtaacat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13120448 |
attaaattaaattatcaaatcatatatccttaattgaacaagtagcaatagattccatccgttgcatgcatatttataatgttggcttagttggtaacat |
13120547 |
T |
|
| Q |
213 |
taaggctaaccaaaaacaattataaggtagata |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13120548 |
taaggctaaccaaaaacaattataaggtagata |
13120580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University