View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9401_low_95 (Length: 252)
Name: NF9401_low_95
Description: NF9401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9401_low_95 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 21 - 246
Target Start/End: Original strand, 52577698 - 52577923
Alignment:
| Q |
21 |
cctgcactatatatatgttgctgttaagtcttggaaacattgtttttataaaaatgctttgatttgatgtgctagacgaacaagcattttaattgagggg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52577698 |
cctgcactatatatatgttgctgttaagtcttggaaacattgtttttataaaaatgctttgatttgatgtgctagacgaactagcattttaattgagggg |
52577797 |
T |
 |
| Q |
121 |
aggaacaaaagactatatattaagatgatgtttatattggaaatgcctaatcaccttattccctcttgagatgcgaaggtttcctgaatgcgataagtat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52577798 |
aggaacaaaagactatatattaagatgatgtttatattggaaatgcctaatcaccttattccctcttgagatgcgaaggtttcctgaatgcgataagtat |
52577897 |
T |
 |
| Q |
221 |
gtggtgtctaaccaaccctttgcttc |
246 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52577898 |
gtggtgtctaaccaaccctttgcttc |
52577923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University