View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9402_low_7 (Length: 240)
Name: NF9402_low_7
Description: NF9402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9402_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 45392238 - 45392034
Alignment:
| Q |
1 |
tttatatttgtacatattgacatgctaattaaacttgtaccatcattctgcaccagattgcataagcaacctctttataaccctaaaatcttgctcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45392238 |
tttatatttgtacatattgacatgctaattaaacttgtaccatcattctgcaccagattgcataagcaacctctttataaccctaaaatcttgctcttca |
45392139 |
T |
 |
| Q |
101 |
actcattttatttttcgaagagaaaacatctcataaattatttgtgattgaaacacatttatacacatagctaacaaaacnnnnnnnaatgaaaccgaca |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
45392138 |
actca-tttatttttcgaagagaaaacatctcataaattatttatgattgaaacacatttatacacatagctaacaatactttttttaatgaaaccgaca |
45392040 |
T |
 |
| Q |
201 |
tggctc |
206 |
Q |
| |
|
|||||| |
|
|
| T |
45392039 |
tggctc |
45392034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University