View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9403_high_7 (Length: 251)
Name: NF9403_high_7
Description: NF9403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9403_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 37536731 - 37536949
Alignment:
| Q |
17 |
ataaataataacagtttcgtctccatttttatattgttgctgttttttctatataagataagatttcttcttgacagcatgaaaatactttaatattctg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37536731 |
ataaataataacagtttcgtctccatttttatattgttgctgttttttctatataagataagatttcttcttgacagcatgaaaatactttaatattctg |
37536830 |
T |
|
| Q |
117 |
gcaccatggattagttgcatacatgaattaggtgtgcaccattagggaactagaaaagcctcaaagtgattgacctgcacatctcccatatatttaacaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37536831 |
gcaccatggattagttgcatacatgaattaggtgtgcaccattagggaactaaaaaagcctcaaagtgattgacctgcacatctcccatatatttaacaa |
37536930 |
T |
|
| Q |
217 |
atcatcattcataagaatt |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37536931 |
atcatcattcataagaatt |
37536949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University