View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9403_low_22 (Length: 247)
Name: NF9403_low_22
Description: NF9403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9403_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 4781684 - 4781924
Alignment:
| Q |
1 |
tcagctgtaggtgccattgaaggaataaatgcaataacaacagggaagcttatcaacctttcagagcaagagcttttggattgtgaccctataagtgggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4781684 |
tcagctgtaggtgccattgaaggaataaatgcaataacaacagggaagcttatcaacctttcagagcaagagcttttggattgtgaccctataagtgggg |
4781783 |
T |
 |
| Q |
101 |
gttgcaatagtggatgggtcaacaaagcatttgattgggttataagaaacaaaggagttgcattggaaaatgattatccatatagggcagagaagggtgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
4781784 |
gttgcaatagtggatgggtcaacaaagcatttgattgggttataagaaacaaaggagttgcattggataatgattatccatatacggcagagaagggtgt |
4781883 |
T |
 |
| Q |
201 |
ttgcaaagcctcacaggtccttaatttctatcaagtattat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4781884 |
ttgcaaagcctcacaggtccttaatttctatcaaatattat |
4781924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 2 - 226
Target Start/End: Original strand, 4785583 - 4785801
Alignment:
| Q |
2 |
cagctgtaggtgccattgaaggaataaatgcaataacaacagggaagcttatcaacctttcagagcaagagcttttggattgtgaccctataagtggggg |
101 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||| | ||||||| |||||| ||||||||||| |||| || | |
|
|
| T |
4785583 |
cagctgtaggcgccattgaaggaataaatgcaataaaaacagggaagcttattagtctttcagcgcaagaacttttggattgcaaccc------tgcagc |
4785676 |
T |
 |
| Q |
102 |
ttgcaatagtggatgggtcaacaaagcatttgattgggttataagaaacaaaggagttgcattggaaaatgattatccatatagggcagagaagggtgtt |
201 |
Q |
| |
|
||||| | ||||| || ||||| ||||| |||||||||||||||| |||| |||||| ||| |||||||| | |||| |||| | |||||| || |
|
|
| T |
4785677 |
atgcaacactggatttgtgaacaatgcattcaattgggttataagaaatggaggacttgcatcggattatgattatgcttatacggcaaaaaagggtttt |
4785776 |
T |
 |
| Q |
202 |
tgcaaagcctcacaggtccttaatt |
226 |
Q |
| |
|
|||| |||||||||||| ||||||| |
|
|
| T |
4785777 |
tgcagagcctcacaggttcttaatt |
4785801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University