View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9404_high_5 (Length: 271)
Name: NF9404_high_5
Description: NF9404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9404_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 11 - 184
Target Start/End: Original strand, 10425324 - 10425498
Alignment:
| Q |
11 |
tagagtgtaatcttgatgataacccatttctcatgggtgttcccctcttcagtgacacgatttcaagacggcttggcaggacgatt-caatcccgggtaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
10425324 |
tagagtgtaatcttgatgataacccatttctcatgggtgttctcctcttcagtgacacgatttcaagacggcttggcatgacgatttcaatcctgggtaa |
10425423 |
T |
|
| Q |
110 |
tgagtgagtagaagtcttaattagaagcggattatattgtgtttctatgtgggaagatatttgacggttattaag |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10425424 |
tgagtgagtagaagtcttaattagaagcggattatattgtgtttctatgtgggaagatatttgaaggttattaag |
10425498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 259
Target Start/End: Original strand, 10426116 - 10426163
Alignment:
| Q |
212 |
ctaattggaacggtgaatgtaagaataatacctccaagcagattccta |
259 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10426116 |
ctaattggaacagtgaatgtaagaataatacctcccagcagattccta |
10426163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University