View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9404_low_17 (Length: 243)
Name: NF9404_low_17
Description: NF9404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9404_low_17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 13 - 243
Target Start/End: Original strand, 33997164 - 33997394
Alignment:
| Q |
13 |
catcaatacttttgtacattttatccaaacttttccacacatttcttaccggagagctactgttatttttccctgtccagatgaaattggtgctcacatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33997164 |
catcaatacttttgtacattttatccaaacttttccacacatttcttaccggagagctactattatttttccctgtccaaatgaaattggtgctcacatt |
33997263 |
T |
 |
| Q |
113 |
ttctggaacatgttcactactttcggaattggaattaaaagctggcctttgaaaatcaacctcccatctccctacagtgttttcatcgattaagctttta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33997264 |
ttctggaacatgttcactactttcggaattggaattaaaagctggcctttgaaaatcaacctcccatctccctacagtgttttcatcgattaagctttta |
33997363 |
T |
 |
| Q |
213 |
gttgttttaggtaaagaacgaacaatcaaat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33997364 |
gttgttttaggtaaagaacgaacaatcaaat |
33997394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University