View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9406_high_4 (Length: 482)

Name: NF9406_high_4
Description: NF9406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9406_high_4
NF9406_high_4
[»] chr4 (1 HSPs)
chr4 (400-467)||(55714562-55714629)


Alignment Details
Target: chr4 (Bit Score: 68; Significance: 4e-30; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 400 - 467
Target Start/End: Original strand, 55714562 - 55714629
Alignment:
400 ttgagtatttgtgatcttcattatgtcaaattacccctccgttgtattgccatgatccacattcacag 467  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55714562 ttgagtatttgtgatcttcattatgtcaaattacccctccgttgtattgccatgatccacattcacag 55714629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University