View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9406_low_10 (Length: 482)
Name: NF9406_low_10
Description: NF9406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9406_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 4e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 400 - 467
Target Start/End: Original strand, 55714562 - 55714629
Alignment:
| Q |
400 |
ttgagtatttgtgatcttcattatgtcaaattacccctccgttgtattgccatgatccacattcacag |
467 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55714562 |
ttgagtatttgtgatcttcattatgtcaaattacccctccgttgtattgccatgatccacattcacag |
55714629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University