View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9406_low_38 (Length: 214)
Name: NF9406_low_38
Description: NF9406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9406_low_38 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 36458645 - 36458432
Alignment:
| Q |
1 |
gaagtctggactagtcaacagtggagtttcttgggttacatttcacagctcatatgattttgggtatctagttaagattttgactcagaattacttaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458645 |
gaagtctggactagtcaacagtggagtttcttgggttacatttcacagctcatatgattttgggtatctagttaagattttgactcagaattacttaccg |
36458546 |
T |
 |
| Q |
101 |
tctcgattggaggaattcttaagcatcttaac-gaaatattttggacggaatgtctatgatatgaagtatatgatcaaattctgcaacttatatggtggt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458545 |
tctcgattggaggaattcttaagcatcttaacacaaata-tttggacagaatgtctatgatatgaagtatatgatcaaattctgcaacttatatggtggt |
36458447 |
T |
 |
| Q |
200 |
ctggaacgtgttgcc |
214 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36458446 |
ctggaacgtgttgcc |
36458432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University