View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9408_high_2 (Length: 272)
Name: NF9408_high_2
Description: NF9408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9408_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 56 - 260
Target Start/End: Complemental strand, 30968260 - 30968074
Alignment:
| Q |
56 |
cagttttcagactctggctttttcagtaatagagaagatcctgctacttatgaggaagctgcaaagttcaattgttggaaagaggctatggatcaggaaa |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30968260 |
cagttttcagactctggctttttcagtaatagagaagatcctgctacttatgaggaagctgcaaagttcaattgttggaaagaggctatggatcaggaaa |
30968161 |
T |
 |
| Q |
156 |
ttgaagccatagaaagaaatgatacatgggaactaactgatttaccaactggaagcaggaagattagcgtaaaatggatttataagac--aatacaatga |
253 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
30968160 |
ttgaagccatagaaagaaatga--------------------taccaactggaagcaggaagattagtgtaaaatggatttataagacaaaatacaatga |
30968081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University