View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9408_high_5 (Length: 235)
Name: NF9408_high_5
Description: NF9408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9408_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 218
Target Start/End: Original strand, 8912538 - 8912742
Alignment:
| Q |
14 |
cagagatcaagctatgataagcaacaccatcaatctcataaacataataaacttgaccattttcatctttcacttcttcagaactcacattatcagcacc |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8912538 |
cagaaatcaagctatgataagcaacaccatcaatctcataaacataataaacttgaccattttcatctttcacttcttcagaactcacattatcagcacc |
8912637 |
T |
 |
| Q |
114 |
actgattatatcttgcaaattcacatcagaaagtgctaagttgttcaaaacagcatcttttggtgctaactgacgaaacccagaaaggaaagttagatat |
213 |
Q |
| |
|
||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8912638 |
actaataatatcttgcaaattcacatcagaaagtgctaagttgttcaaaacagcatcttttggtgctaactgacgaaacccagaaaggaaagttagatat |
8912737 |
T |
 |
| Q |
214 |
tcttt |
218 |
Q |
| |
|
||||| |
|
|
| T |
8912738 |
tcttt |
8912742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University