View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9408_low_16 (Length: 264)
Name: NF9408_low_16
Description: NF9408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9408_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 19 - 123
Target Start/End: Complemental strand, 38345176 - 38345072
Alignment:
| Q |
19 |
aaatgattacttgcttaattttttctttaaacaaacacattcttatgagttaaaatttccaacatgtattttacatatacatacagatcaggatgaaact |
118 |
Q |
| |
|
||||| |||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||| |
|
|
| T |
38345176 |
aaatgtttacttccttaattttttccttaaacaaacacattcttatgagttaaaatttccaacatgtcttttacatatacatacagattaggatcaaact |
38345077 |
T |
|
| Q |
119 |
cataa |
123 |
Q |
| |
|
||||| |
|
|
| T |
38345076 |
cataa |
38345072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University